Automated summary: This snoRNA sequence is 135 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (snOPY, GeneCards, RefSeq, Ensembl, snoDB, MalaCards, ENA, HGNC, Rfam). Described in 11 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (SNORA46, RF00404). Homo sapiens (human) small nucleolar RNA, H/ACA box 46 (SNORA46) sequence is a product of ENSG00000207493.1, SNORA46, ACA46 snoRNA genes. Found in the human reference genome.
This sequence is found in {{ locations.length }} genome
Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
---|---|---|---|---|---|---|---|---|
Loading genome locations... | ||||||||
Failed to load data from server | ||||||||
No genome locations known | ||||||||
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
AGCACUAUAUUUAAACCUGUGGAUGGGAAUAUUCCCCAUUCUUGGUUACGCUGUAGUGCAAAAGAAUUCCUGGCUCUCUGUUGCACAGCUGACUUGUGCCAUUCUGCUGUUGCUGUAUAGAGUUAAGGAACAUGG
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.