Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Arabidopsis thaliana (thale cress) ath-miR169a-3p URS00000183B9_3702

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ath-miR169a-3p: Ath-mir169a-3p is the passenger strand of the miR169a/* duplex [PMC8688358]. The potential target of ath-mir169a-3p showed a weak target plot (T-plot) signal [PMC8688358]. The targets of ath-mir169a-3p and gma-miR408c-3p were predicted using TarHunter and their cleavage site was determined using PARE datasets [PMC8688358]. The correct sequence of ath-mir169a-3p was found to be 21-nt in size (GGCAAGUUGUCCUUGGCUACA) based on a sharp degradome signal starting 1 nt downstream of the miRBase annotation [PMC8688358]. The 3′ end of ath-mir169a-3p reads from sRNA-seq data was found to be ragged [PMC8688358]. According to miRBase annotation, the length of ath-mir169a-3p is 20-nt with the sequence GGCAAGUUGUCCUUGGCUAC [PMC8688358]. Reference: [PMC8688358]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCAAGUUGUCCUUGGCUAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications