Caution, this is an AI generated summary based on literature. This may have errors, see here for more.
Please share your feedback with us.
ath-miR169a-3p: Ath-mir169a-3p is the passenger strand of the miR169a/* duplex [PMC8688358]. The potential target of ath-mir169a-3p showed a weak target plot (T-plot) signal [PMC8688358]. The targets of ath-mir169a-3p and gma-miR408c-3p were predicted using TarHunter and their cleavage site was determined using PARE datasets [PMC8688358]. The correct sequence of ath-mir169a-3p was found to be 21-nt in size (GGCAAGUUGUCCUUGGCUACA) based on a sharp degradome signal starting 1 nt downstream of the miRBase annotation [PMC8688358]. The 3′ end of ath-mir169a-3p reads from sRNA-seq data was found to be ragged [PMC8688358]. According to miRBase annotation, the length of ath-mir169a-3p is 20-nt with the sequence GGCAAGUUGUCCUUGGCUAC [PMC8688358].
Reference:
[PMC8688358]
Genome locations
Gene Ontology annotations
Ancestor Chart
Loading ontology ancestors...
Failed to load QuickGO Ancestor chart
Sequence
Sequence features are shown above as colored rectangles.
Zoom in and click to view details, or
Reset