Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bombyx mori (domestic silkworm) bmo-miR-252-5p URS00000163C0_7091

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUAAGUACUAGUGCCGCAGGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Aedes aegypti Aae-Mir-252-P2_5p (mature (guide))
  2. Bactrocera dorsalis bdo-miR-252
  3. Capitella teleta cte-miR-252a
  4. Cochliomyia hominivorax mature cho-miR-252
  5. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-252
  6. Culex quinquefasciatus cqu-miR-252-5p
  7. Drosophila melanogaster dme-miR-252-5p
  8. Drosophila pseudoobscura dps-miR-252-5p
  9. Drosophila pseudoobscura pseudoobscura miRNA FBtr0330875_df_nrg
  10. Drosophila simulans dsi-miR-252-5p
  11. Drosophila virilis dvi-miR-252-5p
  12. Heliconius melpomene (postman butterfly) hme-miR-252
  13. Manduca sexta mse-miR-252
  14. Nasonia vitripennis nvi-miR-252
  15. Penaeus japonicus miR-252
  16. Plutella xylostella (diamondback moth) pxy-miR-252
  17. Polistes canadensis pca-miR-252-5p
  18. Tribolium castaneum Tca-Mir-252-P2_5p (mature (guide))
Publications