Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bombyx mori (domestic silkworm) bmo-miR-252-5p URS00000163C0_7091

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Bombyx mori. Annotated by 3 databases (miRBase, RefSeq, ENA). Bombyx mori (domestic silkworm) bmo-miR-252-5p sequence is a product of bmo-miR-252, bmo-miR-252-5p, miR-252-5p, Mir252, miR-252 genes. Found in the Bombyx mori reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    CUAAGUACUAGUGCCGCAGGAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 18 other species

    1. Aedes aegypti (yellow fever mosquito) Aae-Mir-252-P2_5p (mature (guide))
    2. Bactrocera dorsalis bdo-miR-252
    3. Capitella teleta cte-miR-252a
    4. Cochliomyia hominivorax mature cho-miR-252
    5. Cochliomyia macellaria mature cma-miR-252
    6. Culex quinquefasciatus cqu-miR-252-5p
    7. Drosophila melanogaster dme-miR-252-5p
    8. Drosophila pseudoobscura dps-miR-252-5p
    9. Drosophila pseudoobscura pseudoobscura miRNA FBtr0330875_df_nrg
    10. Drosophila simulans dsi-miR-252-5p
    11. Drosophila virilis dvi-miR-252-5p
    12. Heliconius melpomene (postman butterfly) hme-miR-252
    13. Manduca sexta mse-miR-252
    14. Nasonia vitripennis nvi-miR-252
    15. Penaeus japonicus miR-252
    16. Plutella xylostella pxy-miR-252
    17. Polistes canadensis pca-miR-252-5p
    18. Tribolium castaneum Tca-Mir-252-P2_5p (mature (guide))
    Publications