Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Penaeus japonicus miR-252 URS00000163C0_27405

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUAAGUACUAGUGCCGCAGGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Aedes aegypti Aae-Mir-252-P2_5p (mature (guide))
  2. Bactrocera dorsalis bdo-miR-252
  3. Bombyx mori bmo-miR-252-5p
  4. Capitella teleta cte-miR-252a
  5. Cochliomyia hominivorax (primary screw-worm) mature cho-miR-252
  6. Cochliomyia macellaria mature cma-miR-252
  7. Culex quinquefasciatus cqu-miR-252-5p
  8. Drosophila melanogaster (fruit fly) dme-miR-252-5p
  9. Drosophila pseudoobscura dps-miR-252-5p
  10. Drosophila pseudoobscura pseudoobscura miRNA FBtr0330875_df_nrg
  11. Drosophila simulans dsi-miR-252-5p
  12. Drosophila virilis dvi-miR-252-5p
  13. Heliconius melpomene (postman butterfly) hme-miR-252
  14. Manduca sexta mse-miR-252
  15. Nasonia vitripennis nvi-miR-252
  16. Plutella xylostella pxy-miR-252
  17. Polistes canadensis pca-miR-252-5p
  18. Tribolium castaneum Tca-Mir-252-P2_5p (mature (guide))