Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-652 URS0000013DD8_9913

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Bos taurus. Annotated by 3 databases (RefSeq, MirGeneDB, miRBase). Described in 4 papers. Bos taurus (cattle) bta-miR-652 sequence is a product of bta-miR-652, miR-652, MIR652 genes. Found in the cattle reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AAUGGCGCCACUAGGGUUGUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 105 other species

    1. Callithrix jacchus cja-miR-652a
    2. Canis lupus familiaris (dog) Cfa-Mir-652_3p (mature (guide))
    3. Cavia porcellus Cpo-Mir-652_3p (mature (guide))
    4. Cricetulus griseus cgr-miR-652-3p
    5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-652-3p
    6. Echinops telfairi Ete-Mir-652_3p (mature (guide))
    7. Equus caballus eca-miR-652
    8. Gorilla gorilla ggo-miR-652
    9. Homo sapiens (human) hsa-miR-652-3p
    10. Macaca mulatta mml-miR-652
    11. Mus musculus mmu-miR-652-3p
    12. Oryctolagus cuniculus (rabbit) Ocu-Mir-652_3p (mature (guide))
    13. Pan troglodytes ptr-miR-652
    14. Pongo pygmaeus (Bornean orangutan) ppy-miR-652
    15. Rattus norvegicus rno-miR-652-3p
    Publications New