Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-652 URS0000013DD8_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-652: Bta-mir-652 is a microRNA that has been studied in various contexts. In a study comparing miRNA profiles of bovine growth and atresia follicles, bta-mir-652 was found to be upregulated in large healthy follicles compared to small follicles, suggesting its functional role in follicular atresia [PMC10080932]. However, its expression was inconsistent, possibly due to its low expression levels [PMC4967221]. Bta-mir-652 has also been found to be upregulated in large healthy follicles compared to small follicles and is involved in signaling pathways related to follicular cell proliferation and steroid generation [PMC8316591]. In another study, bta-mir-652 was detected as the only differentially abundant miRNA on the X chromosome in bovine sperm [PMC7505075]. Bta-mir-652 has also been identified as one of the miRNAs significantly enriched within biological processes related to gene silencing and RNA-induced silencing complex [PMC6722470]. Furthermore, bta-mir-652 has been shown to be involved in biological regulation, cellular processes, cell death, establishment of localization, growth, and disease development [PMC6722470]. It is worth noting that bta-mir-652 has shown correlations with specific genera of bacteria such as Ruminococcus 1 and Ruminococcus 2 [PMC9378797]. Finally, bta-mir-652 has been identified as one of the differentially expressed miRNAs in response to Gram-positive bacteria S. uberis infection [PMC3589390].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAUGGCGCCACUAGGGUUGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Callithrix jacchus cja-miR-652a
  2. Canis lupus familiaris (dog) Cfa-Mir-652_3p (mature (guide))
  3. Cavia porcellus Cpo-Mir-652_3p (mature (guide))
  4. Cricetulus griseus cgr-miR-652-3p
  5. Dasypus novemcinctus dno-miR-652-3p
  6. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-652_3p (mature (guide))
  7. Equus caballus (horse) eca-miR-652
  8. Gorilla gorilla gorilla ggo-miR-652 (MIR652)
  9. Gorilla gorilla (western gorilla) ggo-miR-652
  10. Homo sapiens hsa-miR-652-3p
  11. Macaca mulatta mml-miR-652
  12. Mus musculus mmu-miR-652-3p
  13. Oryctolagus cuniculus (rabbit) Ocu-Mir-652_3p (mature (guide))
  14. Pan troglodytes ptr-miR-652
  15. Pongo pygmaeus ppy-miR-652
  16. Rattus norvegicus rno-miR-652-3p
Publications