v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) ITGA6 antisense RNA 1 (ITGA6-AS1) URS00000137A7_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ITGA6-AS1: ITGA6-AS1 is a long non-coding RNA (lncRNA) that has been studied in the context of MSCs (mesenchymal stem cells) and its potential association with ITGA6 expression. ITGA6-AS1 is significantly higher in MSCs from bone marrow (BM), cord blood (CB), and placenta (PC) compared to other sources [PMC9535380]. It has been found to overlap with the ITGA6 exon 2 sequence and may be involved in the regulation of ITGA6 [PMC9535380]. The expression of ITGA6-AS1 is inversely correlated with that of ITGA6, suggesting its potential role in regulating ITGA6 expression [PMC9535380]. The sequence features of ITGA6-AS1, including its partial complementarity with the ITGA6 transcript, suggest a potential post-transcriptional influence on the stability of ITGA6 mRNA [PMC9535380]. Additionally, bioinformatic analysis has identified potential microRNA binding sites within the lncRNA sequence [PMC9535380]. Further studies are needed to explore the regulatory role of ITGA6-AS1 on MSC function and fate, as well as its interaction with other lncRNAs and mRNA transcripts [PMC9535380]. It is also suggested that overexpression or inhibition analysis of ITGA6-AS1 could provide insights into its effect on regulating ITGA6 expression [PMC9535380].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCAUGUGAGAACUUUUGGCUGAUGAAUACAAGAUACGCUCAUUCAUUCUCUUCAUUGCUAUGAAAUGAGUUUUUCCACAACCUCCUGCAGAACCUCAACACAUCACUAGGUGGCAACAUCCCUACACCAUAUCGGUUUAGAAACCACGGUUAGGAGGAGCAGCAAAACACGCGGCAUCCCAGUAUGAUUCAGAAGUAAAGUUUACAAUCUUUGAGGCCUGGCUGACUCAUGGAACAACUAGGACAAGAAACAAAGACAAAGAACACACACCUGACUGGACAGAGAUAAACCAAGAGCUGAGAGUUUUGGAAACAAGGCUGGAGCUGAGGAAAAGGACUGGGAACACGAACCUGUACAAACAACAAAUUCUUACAACAGAAAACAAGCCACUCCUGGCCAUCAAGAAACCCACAAAUCUCAGAAGCAAAAGCAAAACAAAUGAAAAUACAAACCAAAUAGUCUCUAUUACCUUCAUGCCUGUUGGGUCCCAAUAAAGGAAUCAUUCCAAUAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications