v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla gorilla ggo-miR-146b (MIR146B) URS00000114BC_9595

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGAGAACUGAAUUCCAUAGGCUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 26 other species

  1. Bos taurus bta-miR-146b
  2. Callithrix jacchus cja-miR-146b
  3. Canis lupus familiaris Cfa-Mir-146-P1_5p (mature (guide))
  4. Capra hircus chi-miR-146b-5p
  5. Cervus elaphus (red deer) cel-miR-146b
  6. Dasypus novemcinctus dno-miR-146b-5p
  7. Drosophila erecta Drosophila_erecta piRNA piR-der-736299
  8. Drosophila melanogaster Drosophila_melanogaster piRNA piR-dme-21310294
  9. Echinops telfairi Ete-Mir-146-P1_5p (mature (guide))
  10. Gallus gallus (chicken) Gallus_gallus piRNA piR-gga-63814
  11. Gorilla gorilla (western gorilla) ggo-miR-146b
  12. Homo sapiens Hsa-Mir-146-P1_5p (mature (guide))
  13. Macaca mulatta (Rhesus monkey) Mml-Mir-146-P1_5p (mature (guide))
  14. Microcebus murinus mmr-miR-146b
  15. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-146-P1_5p (mature (guide))
  16. Mus musculus (house mouse) Mmu-Mir-146-P1_5p (mature (guide))
  17. Nomascus leucogenys nle-miR-146b
  18. Ornithorhynchus anatinus Oan-Mir-146-P1_5p (mature (guide))
  19. Pan paniscus (pygmy chimpanzee) ppa-miR-146b
  20. Papio hamadryas (hamadryas baboon) pha-miR-146b
  21. Petromyzon marinus Pma-Mir-146_5p (mature (guide))
  22. Pteropus alecto pal-miR-146b-5p
  23. Rattus norvegicus (Norway rat) rno-miR-146b-5p
  24. Saimiri boliviensis boliviensis sbo-miR-146b
  25. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-146-P1_5p (mature (guide))
  26. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-601189
 Publications