Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-146b URS00000114BC_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-146b: Bta-mir-146b is a candidate miRNA that has been associated with Wnt signals and the MAPK pathway [PMC9445238]. Other studies have also identified several miRNAs, such as bta-miR-19a, bta-miR-19b, bta-miR-21-5p, bta-miR-29c, bta-miR-143, and bta-miR-145, that are associated with these signaling pathways [PMC9445238].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGAACUGAAUUCCAUAGGCUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 26 other species

Publications