Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-320c URS0000010D30_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-320c: Hsa-mir-320c is a microRNA present in plasma extracellular vesicles (EVs) that has been associated with disease progression in certain clinical contexts [PMC8121992]. It has been found that hsa-mir-320c, along with hsa-miR-320d and hsa-miR-320b, is significantly upregulated in patients with progressive disease (PD) compared to those exhibiting a partial response (PR) to immunotherapy, suggesting its potential utility as a biomarker for monitoring treatment response [PMC8121992]. However, while hsa-mir-320c was significantly differentially expressed, it was not identified as one of the most significant microRNAs when applying stringent criteria for differential expression (logCPM>4, p<0.05, FDR≤0.1); instead, hsa-miR-320d and hsa-miR-642a-3p were noted as the most significant in the study [PMC7057418].

mRNA interactions 24 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAAGCUGGGUUGAGAGGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

Relationships

Molecular Relationships

GoFlow Results Publications