Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Xenopus tropicalis (tropical clawed frog) xtr-miR-26 URS000000E09E_8364

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Xenopus tropicalis. Annotated by 3 databases (miRBase, RefSeq, PirBase). Xenopus tropicalis (tropical clawed frog) xtr-miR-26 sequence is a product of mir26-2, miR-26, xtr-miR-26, mir26-1 genes. Found in the Xenopus tropicalis reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UUCAAGUAAUCCAGGAUAGGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 10 other species

    1. Bos taurus microRNA miR-26a
    2. Capra hircus (goat) miR-26a
    3. Gallus gallus (chicken) gga-miR-26a-5p
    4. Hippoglossus hippoglossus (Atlantic halibut) hhi-miR-26
    5. Monodelphis domestica mdo-miR-26-5p
    6. Mus musculus Mus_musculus piRNA piR-mmu-72537
    7. Oryzias latipes (Japanese medaka) ola-miR-26
    8. Ovis aries (sheep) miscellaneous RNA
    9. Rattus norvegicus (Norway rat) Rattus_norvegicus piRNA piR-rno-63023
    10. Tursiops truncatus miR-26a
    Publications