Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-26a-5p URS000000E09E_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-26a: gga-mir-26a is a microRNA that has been found to play a role in inhibiting the proliferation of Marek's disease lymphoma cells (Li X. et al., 2014; Lian et al., 2015) [PMC5021716]. It is part of a larger network of microRNAs, including gga-miR-221/222 and gga-miR-181a, that are involved in suppressing the cell cycle and inhibiting proliferation in T-cell lymphoma (Li X. et al., 2014; Lian et al., 2015) [PMC5021716]. The interaction of gga-mir-26a has been found to be significant with EIF3A, while gga-miR-181a has been shown to interact with MYBL1 and IGF2BP3 (Li X. et al., 2014; Lian et al., 2015) [PMC3511444]. These findings highlight the importance of microRNAs, including gga-mir-26a, in regulating cell cycle and proliferation in Marek's disease lymphoma cells. Further research is needed to fully understand the mechanisms by which these microRNAs interact with their target genes and how they can be targeted for potential therapeutic interventions.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCAAGUAAUCCAGGAUAGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

Publications