Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 74B (SNORA74B) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 74B (SNORA74B) URS000000D517_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA74B: SNORA74B is a type of small nucleolar RNA (snoRNA) that has been studied in relation to gallbladder cancer (GBC) [PMC5386738]. Higher expression of SNORA74B has been found to be positively associated with increased local invasion, advanced tumor stage, increased carbohydrate antigen 19-9 (CA 19-9) levels, and high expression of Ki67 [PMC5386738]. Conversely, SNORA74B expression was negatively associated with the expression of PHLPP [PMC5386738]. Silencing SNORA74B was found to inhibit proliferation, induce G1 arrest, and promote apoptosis in GBC cells [PMC5386738]. The regulation of PHLPP by SNORA74B may involve RNA-protein interaction and epigenetic suppression mechanisms [PMC5386738]. The relationship between SNORA74B expression and clinicopathological features was analyzed using chi-square analysis [PMC5386738]. Additionally, receiver operating characteristic (ROC) curve analysis was performed to determine the sensitivity and specificity of SNORA74B expression in discriminating tumor tissues from non-tumor tissues [PMC5386738]. The study suggests that if detectable in blood, SNORA74B combined with CA19-9 could serve as valuable diagnostic indicators for GBC [PMC5386738]. In terms of differential gene expression analysis, SNORA74B was not found to be one of the top five most down-regulated microRNAs in GBC cells compared to non-tumor cells [PMC8366141]. The study also investigated the potential molecular mechanisms by which silencing SNORA74B inhibits proliferation and promotes apoptosis by examining the activation of the AKT/mTOR pathway after siRNA knockdown [PMC5386738]. Overall, these findings highlight the potential role of SNORA74B as a diagnostic indicator for GBC and its involvement in regulating cellular processes in GBC cells [PMC5386738][PMC8366141].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUCCAGCAGUAGUCAGCCAUCCGGACAGAACCGUUCCUGUGAUGGUGUUACACUGCUGGGAGAGGAAUGUCUUGUCUUCAUCCGGUUGCCUGCGCCACUGUUCUGGUGGCGUCUGGCACUGGUGCAAGACAGAGCUGUGCUUCCCCGAGAGUGUGCUAAGCAUUCACUUUGGCUGCUUAGUUCUAGUCUGGGAGCAGACAGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications