Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryctolagus cuniculus (rabbit) ocu-miR-152-5p URS000000C73C_9986

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Oryctolagus cuniculus. Annotated by 3 databases (RefSeq, MirGeneDB, miRBase). Described in 3 papers. Oryctolagus cuniculus (rabbit) ocu-miR-152-5p sequence is a product of ocu-miR-152-5p, miR-152, miR-152-5p, MIR152, ocu-miR-152 genes. Found in the rabbit reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AGGUUCUGUGAUACACUCCGACU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 16 other species

    1. Bos taurus (cattle) Bta-Mir-148-P2_5p* (star (passenger))
    2. Canis lupus familiaris Cfa-Mir-148-P2_5p* (star (passenger))
    3. Cervus elaphus (red deer) cel-miR-152-5p
    4. Cricetulus griseus cgr-miR-152-5p
    5. Homo sapiens hsa-miR-152-5p
    6. Macaca mulatta mml-miR-152-5p
    7. Monodelphis domestica mdo-miR-152-5p
    8. Mus musculus (house mouse) Mmu-Mir-148-P2_5p* (star (passenger))
    9. Pteropus alecto pal-miR-152-5p
    10. Rattus norvegicus rno-miR-152-5p