Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pteropus alecto (black flying fox) pal-miR-152-5p URS000000C73C_9402

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGUUCUGUGAUACACUCCGACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Cervus elaphus (red deer) cel-miR-152-5p
  2. Cricetulus griseus cgr-miR-152-5p
  3. Homo sapiens hsa-miR-152-5p
  4. Macaca mulatta (Rhesus monkey) mml-miR-152-5p
  5. Monodelphis domestica (gray short-tailed opossum) mdo-miR-152-5p
  6. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-50281734
  7. Oryctolagus cuniculus ocu-miR-152-5p
  8. Rattus norvegicus (Norway rat) rno-miR-152-5p