Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-152-5p URS000000C73C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-152: Hsa-mir-152 is a microRNA that has been associated with various diseases and conditions. It has been found to be altered in the early stage of Hepatitis C Virus (HCV) infection and is associated with a deterioration in liver function and increased severity of HCV [PMC10138470]. In gastric cancer cell lines, the expression of hsa-mir-152 was significantly downregulated [PMC8548500]. It has also been reported that hsa-mir-152 is repressed in endometrial cancer compared to normal tissue, suggesting its potential as a biomarker for endometrial cancer [PMC5453480]. In a study on colorectal adenocarcinoma patients, hsa-mir-152 was identified as an independent prognostic factor [PMC7047168]. Hsa-mir-152 has also been predicted to target TGFA in a network analysis, suggesting its potential role in regulating TGFA expression [PMC5663837]. Computational analysis identified hsa-mir-152 as one of the microRNAs predicted to regulate the expression of DNMT1 and DNMT3a/b [PMC4334912]. The expression levels of hsa-mir-152 have been found to be differentially expressed between drug-sensitive and drug-resistant tissues [PMC4706521]. Hsa-mir-152 has also been identified as one of the top miRNAs based on topological features in network analysis studies [PMC5453480][PMC7578500]. Overall, hsa-mir-152 is an important microRNA that plays a role in various diseases and conditions. Its altered expression levels have been associated with HCV infection, gastric cancer, endometrial cancer, colorectal adenocarcinoma, drug resistance, and other conditions. Further research is needed to fully understand its mechanisms and potential therapeutic implications.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGUUCUGUGAUACACUCCGACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Cervus elaphus cel-miR-152-5p
  2. Cricetulus griseus (Chinese hamster) cgr-miR-152-5p
  3. Macaca mulatta mml-miR-152-5p
  4. Monodelphis domestica mdo-miR-152-5p
  5. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-50281734
  6. Oryctolagus cuniculus ocu-miR-152-5p
  7. Pteropus alecto pal-miR-152-5p
  8. Rattus norvegicus (Norway rat) rno-miR-152-5p
Publications