Citrus sinensis (sweet orange) csi-miR166a-3p URS000000A3C9_2711

• 22 nucleotides
• 2 databases (miRBase, RefSeq)
• Found in 7 other species
• 172 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Citrus sinensis. Annotated by 2 databases (miRBase, RefSeq). Citrus sinensis (sweet orange) csi-miR166a-3p sequence is a product of miR166, MIR166A, miR166a-3p, csi-miR166a-3p, csi-miR166a, miR166a genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location	Chromosome	Start	End	Strand	Ensembl	UCSC	Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
Go to location loading browser Can't view - strange chromosome name	{{ location.chromosome }}	{{ location.start | number }}	{{ location.end | number }}	{{ location.strand == "1" ? "forward" : "reverse" }}	{{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }}	UCSC	100%	{{ location.identity * 100 | number:0 }}%

No genome locations found for this sequence. Learn more →

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UCGGACCAGGCUUCAUUCCCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

1. Ananas comosus (pineapple) microRNA 166a
2. Arabidopsis thaliana (thale cress) AGO1_1496
3. Citrus trifoliata ctr-miR166
4. Hevea brasiliensis hbr-miR166b
5. Linum usitatissimum lus-miR166k
6. Prunus persica microRNA miRNA_265
7. Vitis vinifera (wine grape) miRNA MIR166e_4H-8

Publications Download

• FASTA
• JSON