Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Arabidopsis thaliana (thale cress) AGO1_1496 URS000000A3C9_3702

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCGGACCAGGCUUCAUUCCCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Ananas comosus (pineapple) microRNA 166a
  2. Citrus sinensis (sweet orange) csi-miR166a-3p
  3. Citrus trifoliata (trifoliate orange) ctr-miR166
  4. Hevea brasiliensis hbr-miR166b
  5. Linum usitatissimum lus-miR166i
  6. Prunus persica microRNA miRNA_265
  7. Vitis vinifera miRNA MIR166e_4H-8