Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) PRRT3 antisense RNA 1 (PRRT3-AS1) URS0000008D1D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

PRRT3-AS1: PRRT3-AS1 is a long non-coding RNA (lncRNA) that has been identified as one of the 15 immune-related prognostic lncRNAs in prostate cancer (PC) [PMC7441444]. The identification of these lncRNAs was done through univariate Cox regression analysis using TCGA and CGGA (mRNAseq_325) as the training cohort [PMC7441444]. PRRT3-AS1 was found to be highly expressed in PC [PMC9283041]. The other immune-related prognostic lncRNAs identified include LINC00461, LINC00511, CPB2-AS1, AC092171.2, LINC00665, ARHGAP31-AS1, AC006449.1, TRAPPC12-AS1, AC144831.1, TRAM2-AS1, LINC00460, CACNA1C-AS1, RNF219-AS1 and DNAH10OS [PMC7441444]. These findings suggest that PRRT3-AS1 may play a role in the immune response and prognosis of PC. Further research is needed to understand the specific mechanisms through which PRRT3-AS1 functions in PC and its potential as a therapeutic target.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGUCUGUCGCGAGCAACCCUACACCAUGCACCAGCGCCACUGCUCCCAGCAGGAGUGGGUUUUGCAGCGGUGGCGGCAGCCCCGCGCCCAGGCCGAGCAGAGUCAGGGCUGCCAGCGCCGUAAGCAGCAAGGGGAAGGGCAGGUUGUAGAGCACCAGGCCCCCGCGAACGCCCAGCCGCGCCUGCGAGCCGUAAGGGUCGUGUGGUUGGCAAGUCAUUUAACUUUUCCAAACAAAUCUGCAAAAUGGAGAUAACAGCACCUGCCUCAUUGCGUUGUGAAGAAGAUGAAAUGUUUAGCCCGGUGCCCAACACCCAGUUCUCACUCUGUCAUCCAGGCUGGUGUGCAGUGGUGCAAUGUGGGCUUACUGCAGCCUUGACCUCCAGGACAAGUGAUCUCCCACCUCAGCCUCCGGAAUAGCUGGGACUACAGCUCAACAACGCCCCUCUGAAAGUAGGACUCUUGGAAAUGAACCUUGUUGGGAGUAAAGCUGAACCUUCACCUCUCCUUUCCAGGAUUCUACUCCAUUCAUACGGCCUCACACUGAAUUAAUGUUUCUAGCAGCCACAUUACUUUGUUACCCAAUUGAUCUAGUAGUAAAGUCUUCCCAUCUCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications