Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-143 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-143 precursor URS0000008A99_9606

  • 106 nucleotides
  • 9 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, MalaCards, miRBase, RefSeq, Rfam)
  • Found in 14 species

Automated summary: This pre miRNA sequence is 106 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (Rfam, Ensembl/GENCODE, GeneCards, miRBase, MalaCards, RefSeq, HGNC, ENA, Ensembl). Described in 64 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-143, RF00683). Homo sapiens (human) microRNA hsa-mir-143 precursor sequence is a product of mir-143 precursor, MIR143, ENSG00000284182.1, mir-143 precurso, hsa-mir-143 precursor, 143, mir-143 genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 13 other species

    2D structure New