Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) RNA, 5.8S ribosomal N1 (RNA5-8SN 1 to 3, RNA5-8SN5) secondary structure diagram

Homo sapiens (human) RNA, 5.8S ribosomal N1 (RNA5-8SN 1 to 3, RNA5-8SN5) URS0000005270_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

RNA5-8SN1: RNA5-8SN1 is a small nuclear RNA (snRNA) that is part of a cluster of genes with common functions, including upregulated genes [PMC6839856]. These clusters consist of non-coding RNAs (ncRNAs) that form a common subunit, such as RNA5-8SN1 [PMC8796169]. In a study on milk maturity, RNA5-8SN1 was found to be one of the 17 most abundant ncRNAs affected by milk maturity [PMC8796169]. To normalize the data, the expression of RNA5-8SN1 was compared to other RNA polymerase I and III transcripts that are not affected by P-TEFb inhibition [PMC9356186]. In another study, data files were mapped to rRNA sequences including RNA5-8SN1 to eliminate rRNA contaminant reads [PMC6379413]. In human samples, the rRNAs included NR_003285.3 (RNA5-8SN1) [PMC9458444]. Furthermore, in a study on gene expression in iron metabolism and lipoprotein assembly pathways, RNA5-8SN1 was found to be one of the differentially expressed genes linked to these pathways [PMC7222197]. Finally, in an analysis excluding certain genes from the rDNA gene family, RNA5-8SN1 was not specifically mentioned as one of the excluded genes [PMC8954558].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGACUCUUAGCGGUGGAUCACUCGGCUCGUGCGUCGAUGAAGAACGCAGCUAGCUGCGAGAAUUAAUGUGAAUUGCAGGACACAUUGAUCAUCGACACUUCGAACGCACUUGCGGCCCCGGGUUCCUCCCGGGGCUACGCCUGUCUGAGCGUCGCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications