5.8S ribosomal RNA from Mus musculus (PDB 6SWA, chain r)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

5.8S ribosomal RNA from Mus musculus (PDB 6SWA, chain r) URS0000005270_10090

157 nucleotides
2 databases (ENA, PDBe)
Found in 13 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

CGACUCUUAGCGGUGGAUCACUCGGCUCGUGCGUCGAUGAAGAACGCAGCUAGCUGCGAGAAUUAAUGUGAAUUGCAGGACACAUUGAUCAUCGACACUUCGAACGCACUUGCGGCCCCGGGUUCCUCCCGGGGCUACGCCUGUCUGAGCGUCGCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

Oryctolagus cuniculus 5.8S ribosomal RNA from Oryctolagus cuniculus (PDB 6GZ4, chain A3)
Callithrix jacchus RNA5-8S (LOC110006321)
Cricetulus griseus 5.8S ribosomal RNA (Rn5-8s)
Gorilla gorilla (western gorilla) 5.8S ribosomal RNA
Homo sapiens RNA, 5.8S ribosomal N1 (RNA5-8SN 1 to 3, RNA5-8SN5)
Macaca mulatta RNA, 5.8S ribosomal (LOC109910386)
Nomascus leucogenys (northern white-cheeked gibbon) 5.8S ribosomal RNA
Pan troglodytes (chimpanzee) 5.8S ribosomal RNA
Pongo abelii (Sumatran orangutan) 5.8S ribosomal RNA
Rattus sp. 5.8S rRNA
Rattus norvegicus RNA (157-MER) from Rattus norvegicus (PDB 7QGG, chain D)

2D structure