Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Xenopus tropicalis (tropical clawed frog) xtr-miR-15c URS0000003D7D_8364

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Xenopus tropicalis. Annotated by 4 databases (miRBase, MirGeneDB, PirBase, RefSeq). Xenopus tropicalis (tropical clawed frog) xtr-miR-15c sequence is a product of miR-15, mir15c, miR-15c, xtr-miR-15c genes. Found in the tropical clawed frog reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UAGCAGCACAUCAUGGUUUGUA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 13 other species

    1. Alligator mississippiensis (American alligator) ami-miR-15c-5p
    2. Callorhinchus milii (elephant shark) eshark_mir-15_4
    3. Chrysemys picta bellii Cpi-Mir-15-P1c_5p (mature (guide))
    4. Columba livia cli-miR-15c-5p
    5. Danio rerio (zebrafish) dre-miR-15b-5p
    6. Gallus gallus (chicken) gga-miR-15c-5p
    7. Ictalurus punctatus (channel catfish) ipu-miR-15b
    8. Latimeria chalumnae (coelacanth) Lch-Mir-15-P1c_5p (mature (guide))
    9. Ornithorhynchus anatinus Oan-Mir-15-P1c_5p (mature (guide))
    10. Sphenodon punctatus Spt-Mir-15-P1c_5p (mature (guide))
    11. Taeniopygia guttata (zebra finch) Tgu-Mir-15-P1c_5p (mature (guide))
    12. Tor tambroides miR-15b-5p
    13. Xenopus laevis xla-miR-15c-5p