v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Chrysemys picta bellii (western painted turtle) Cpi-Mir-15-P1c_5p (mature (guide)) URS0000003D7D_8478

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UAGCAGCACAUCAUGGUUUGUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Alligator mississippiensis (American alligator) ami-miR-15c-5p
  2. Callorhinchus milii eshark_mir-15_4
  3. Columba livia cli-miR-15c-5p
  4. Danio rerio dre-miR-15b-5p
  5. Gallus gallus gga-miR-15c-5p
  6. Ictalurus punctatus (channel catfish) ipu-miR-15b
  7. Latimeria chalumnae Lch-Mir-15-P1c_5p (mature (guide))
  8. Ornithorhynchus anatinus Oan-Mir-15-P1c_5p (mature (guide))
  9. Sphenodon punctatus (tuatara) Spt-Mir-15-P1c_5p (mature (guide))
  10. Taeniopygia guttata (zebra finch) Tgu-Mir-15-P1c_5p (mature (guide))
  11. Tor tambroides (Thai mahseer) miR-15b-5p
  12. Xenopus laevis (African clawed frog) xla-miR-15c
  13. Xenopus tropicalis (tropical clawed frog) xtr-miR-15c