Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-15b-5p URS0000003D7D_7955

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Danio rerio. Annotated by 4 databases (miRBase, MirGeneDB, RefSeq, ENA). Described in 10 papers. Danio rerio (zebrafish) dre-miR-15b-5p sequence is a product of miR-15b, miR-15, miR-15b-5p, mir15b, dre-miR-15b, dre-miR-15b-5p genes. Found in the zebrafish reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAGCAGCACAUCAUGGUUUGUA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 17 other species

    1. Alligator mississippiensis ami-miR-15c-5p
    2. Callorhinchus milii eshark_mir-15_4
    3. Chrysemys picta bellii (western painted turtle) Cpi-Mir-15-P1d_5p (mature (guide))
    4. Columba livia cli-miR-15c-5p
    5. Gallus gallus (chicken) gga-miR-15c-5p
    6. Ictalurus punctatus (channel catfish) ipu-miR-15b
    7. Ornithorhynchus anatinus Oan-Mir-15-P1d_5p (mature (guide))
    8. Taeniopygia guttata (zebra finch) Tgu-Mir-15-P1d_5p (mature (guide))
    9. Tor tambroides (Thai mahseer) miR-15b-5p
    10. Xenopus laevis xla-miR-15c-5p
    11. Xenopus tropicalis (tropical clawed frog) xtr-miR-15c