Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Glycine max (soybean) gma-miR169g URS00000036DB_3847

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Glycine max. Annotated by 2 databases (miRBase, RefSeq). Glycine max (soybean) gma-miR169g sequence is a product of miR169, gma-miR169m, miR169m, gma-miR169g, MIR169G, MIR169F, MIR169M, gma-miR169f, miR169a, miR169f, gma-miR169a, MIR169A, miR169g genes. Found in the soybean reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    CAGCCAAGGAUGACUUGCCGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 292 other species

    1. Aegilops tauschii ata-miR169d-5p
    2. Ananas comosus microRNA 169c
    3. Aquilegia coerulea aqc-miR169c
    4. Arabidopsis lyrata aly-miR169b-5p
    5. Arabidopsis thaliana ath-miR169c
    6. Brachypodium distachyon (stiff brome) bdi-miR169c-5p
    7. Brassica napus (rape) bna-miR169n
    8. Camelina sativa cas-miR169b
    9. Citrus sinensis (sweet orange) csi-miR169m-5p
    10. Cucumis melo cme-miR169h
    11. Linum usitatissimum lus-miR169f
    12. Malus domestica mdm-miR169j
    13. Manihot esculenta (cassava) mes-miR169d
    14. Medicago truncatula mtr-miR169l-5p
    15. Nicotiana tabacum (common tobacco) nta-miR169r
    16. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR169b
    17. Oryza sativa osa-miR169b
    18. Petunia x hybrida microRNA mirBL
    19. Populus tomentosa Pto-miR169d
    20. Populus trichocarpa (black cottonwood) ptc-miR169d
    21. Prunus persica ppe-miR169c
    22. Ricinus communis rco-miR169a
    23. Solanum lycopersicum (tomato) sly-miR169a
    24. Sorghum bicolor sbi-miR169k
    25. Theobroma cacao tcc-miR169b
    26. Vigna unguiculata vun-miR169
    27. Vitis vinifera (wine grape) vvi-miR169c
    28. Zea mays zma-miR169c-5p
    Publications New