Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Malus domestica (apple) mdm-miR169a URS00000036DB_3750

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGCCAAGGAUGACUUGCCGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 28 other species

  1. Aegilops tauschii ata-miR169d-5p
  2. Ananas comosus (pineapple) microRNA 169c
  3. Aquilegia coerulea (Rocky Mountain columbine) aqc-miR169c
  4. Arabidopsis lyrata (lyrate rockcress) aly-miR169b-5p
  5. Arabidopsis thaliana (thale cress) ath-miR169b-5p
  6. Brachypodium distachyon (stiff brome) bdi-miR169c-5p
  7. Brassica napus bna-miR169n
  8. Camelina sativa cas-miR169b
  9. Citrus sinensis (sweet orange) csi-miR169r-5p
  10. Cucumis melo (muskmelon) cme-miR169f
  11. Glycine max (soybean) gma-miR169a
  12. Linum usitatissimum (flax) lus-miR169h
  13. Manihot esculenta mes-miR169a
  14. Medicago truncatula (barrel medic) mtr-miR169b
  15. Nicotiana tabacum (common tobacco) nta-miR169q
  16. Oryza sativa (Asian cultivated rice) osa-miR169b
  17. Oryza sativa Japonica Group microRNA osa-miR169b
  18. Petunia x hybrida microRNA mirBL
  19. Populus tomentosa Pto-miR169d
  20. Populus trichocarpa ptc-miR169d
  21. Prunus persica ppe-miR169a
  22. Ricinus communis (castor bean) rco-miR169b
  23. Solanum lycopersicum sly-miR169a
  24. Sorghum bicolor (sorghum) sbi-miR169k
  25. Theobroma cacao (cacao) tcc-miR169k
  26. Vigna unguiculata (cowpea) vun-miR169
  27. Vitis vinifera (wine grape) vvi-miR169a
  28. Zea mays (maize) zma-miR169r-5p
Publications