Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Vitis vinifera (wine grape) vvi-miR169j URS00000036DB_29760

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Vitis vinifera. Annotated by 2 databases (miRBase, RefSeq). Vitis vinifera (wine grape) vvi-miR169j sequence is a product of miR169s, MIR169A, vvi-miR169j, MIR169C, vvi-miR169c, MIR169J, MIR169W, miR169c, miR169w, vvi-miR169s, miR169, vvi-miR169a, vvi-miR169k, miR169a, MIR169K, miR169j, MIR169S, vvi-miR169w, miR169k genes. Found in the wine grape reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    CAGCCAAGGAUGACUUGCCGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 28 other species

    1. Aegilops tauschii ata-miR169d-5p
    2. Ananas comosus microRNA 169c
    3. Aquilegia coerulea aqc-miR169c
    4. Arabidopsis lyrata aly-miR169b-5p
    5. Arabidopsis thaliana (thale cress) ath-miR169c
    6. Brachypodium distachyon (stiff brome) bdi-miR169c-5p
    7. Brassica napus bna-miR169n
    8. Camelina sativa (false flax) cas-miR169b
    9. Citrus sinensis (sweet orange) csi-miR169o-5p
    10. Cucumis melo (muskmelon) cme-miR169f
    11. Glycine max gma-miR169f
    12. Linum usitatissimum lus-miR169f
    13. Malus domestica mdm-miR169j
    14. Manihot esculenta mes-miR169b
    15. Medicago truncatula (barrel medic) mtr-miR169g
    16. Nicotiana tabacum (common tobacco) nta-miR169r
    17. Oryza sativa Japonica Group microRNA osa-miR169b
    18. Oryza sativa (rice) osa-miR169b
    19. Petunia x hybrida microRNA mirBL
    20. Populus tomentosa Pto-miR169d
    21. Populus trichocarpa ptc-miR169d
    22. Prunus persica (peach) ppe-miR169a
    23. Ricinus communis rco-miR169a
    24. Solanum lycopersicum sly-miR169a
    25. Sorghum bicolor sbi-miR169k
    26. Theobroma cacao tcc-miR169k
    27. Vigna unguiculata (cowpea) vun-miR169
    28. Zea mays zma-miR169c-5p
    Publications New