Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Vitis vinifera (wine grape) vvi-miR169j URS00000036DB_29760

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Vitis vinifera. Annotated by 2 databases (RefSeq, miRBase). Described in 3 papers. Vitis vinifera (wine grape) vvi-miR169j sequence is a product of miR169j, vvi-miR169w, MIR169J, vvi-miR169k, miR169, MIR169S, miR169c, MIR169C, vvi-miR169j, miR169k, MIR169W, miR169w, miR169a, MIR169A, miR169s, vvi-miR169s, vvi-miR169a, MIR169K, vvi-miR169c genes. Found in the wine grape reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CAGCCAAGGAUGACUUGCCGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 42 other species

    1. Aegilops tauschii ata-miR169d-5p
    2. Ananas comosus microRNA 169c
    3. Aquilegia coerulea aqc-miR169c
    4. Arabidopsis lyrata aly-miR169b-5p
    5. Arabidopsis thaliana (thale cress) ath-miR169c
    6. Brachypodium distachyon (stiff brome) bdi-miR169f
    7. Brassica napus bna-miR169n
    8. Camelina sativa cas-miR169b
    9. Citrus sinensis (sweet orange) csi-miR169k-5p
    10. Cucumis melo (muskmelon) cme-miR169h
    11. Glycine max gma-miR169g
    12. Linum usitatissimum lus-miR169h
    13. Malus domestica mdm-miR169i
    14. Manihot esculenta (cassava) mes-miR169e
    15. Medicago truncatula (barrel medic) mtr-miR169g
    16. Nicotiana tabacum (common tobacco) nta-miR169r
    17. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR169b
    18. Oryza sativa (rice) osa-miR169c
    19. Petunia x hybrida microRNA mirBL
    20. Populus tomentosa Pto-miR169d
    21. Populus trichocarpa (black cottonwood) ptc-miR169e
    22. Prunus persica (peach) ppe-miR169c
    23. Ricinus communis rco-miR169b
    24. Solanum lycopersicum sly-miR169a
    25. Sorghum bicolor (sorghum) sbi-miR169b
    26. Theobroma cacao tcc-miR169b
    27. Vigna unguiculata (cowpea) vun-miR169
    28. Zea mays zma-miR169c-5p