Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Brachypodium distachyon (stiff brome) bdi-miR169c-5p URS00000036DB_15368

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Brachypodium distachyon. Annotated by 2 databases (miRBase, RefSeq). Brachypodium distachyon (stiff brome) bdi-miR169c-5p sequence is a product of MIR169F, miR169f, bdi-miR169f, miR169c, bdi-miR169c-5p, miR169, miR169c-5p, bdi-miR169c, MIR169C genes. Found in the stiff brome reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    CAGCCAAGGAUGACUUGCCGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 28 other species

    1. Aegilops tauschii ata-miR169d-5p
    2. Ananas comosus microRNA 169c
    3. Aquilegia coerulea aqc-miR169c
    4. Arabidopsis lyrata aly-miR169b-5p
    5. Arabidopsis thaliana (thale cress) ath-miR169c
    6. Brassica napus bna-miR169n
    7. Camelina sativa (false flax) cas-miR169b
    8. Citrus sinensis (sweet orange) csi-miR169o-5p
    9. Cucumis melo (muskmelon) cme-miR169f
    10. Glycine max gma-miR169f
    11. Linum usitatissimum lus-miR169f
    12. Malus domestica mdm-miR169j
    13. Manihot esculenta mes-miR169b
    14. Medicago truncatula (barrel medic) mtr-miR169g
    15. Nicotiana tabacum (common tobacco) nta-miR169r
    16. Oryza sativa Japonica Group microRNA osa-miR169b
    17. Oryza sativa (rice) osa-miR169b
    18. Petunia x hybrida microRNA mirBL
    19. Populus tomentosa Pto-miR169d
    20. Populus trichocarpa ptc-miR169d
    21. Prunus persica (peach) ppe-miR169a
    22. Ricinus communis rco-miR169a
    23. Solanum lycopersicum sly-miR169a
    24. Sorghum bicolor sbi-miR169k
    25. Theobroma cacao tcc-miR169k
    26. Vigna unguiculata (cowpea) vun-miR169
    27. Vitis vinifera vvi-miR169j
    28. Zea mays zma-miR169c-5p
    Publications New