Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Apis mellifera (honey bee) ame-miR-279a-3p URS0000003085_7460

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ame-mir-279a: Ame-mir-279a is a microRNA that has been found to play a role in regulating honey bee division of labor. It is highly expressed in the heads of nurse bees compared to forager bees, and its overexpression decreases the proboscis extension response (PER) to saccharose solution, while its knockdown enhances workers' PER [PMC9863880]. Ame-mir-279a is primarily localized in the Kenyon cells of the mushroom body in both foragers and nurses, and its overexpression enhances the proboscis extension response to sucrose solution, while its knockdown diminishes this response [PMC10058195]. It has been observed that ame-mir-279a shows significantly higher expression in the brains of nurse bees compared to forager bees regardless of their ages [PMC7073825]. Furthermore, ame-mir-279a directly targets the mRNA of Mblk-1 [PMC7073825]. This microRNA has been implicated in regulating honey bee division of labor, as it is highly expressed in nurse bee heads compared to foragers [PMC7073825]. These findings highlight the important role that ame-mir-279a plays in regulating honey bee behavior and division of labor.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGACUAGAUCCACACUCAUUAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Aedes aegypti (yellow fever mosquito) aae-miR-279
  2. Anopheles gambiae aga-miR-279
  3. Culex quinquefasciatus (southern house mosquito) cqu-miR-279-3p
  4. Drosophila ananassae dan-miR-279
  5. Drosophila erecta der-miR-279
  6. Drosophila grimshawi dgr-miR-279
  7. Drosophila melanogaster (fruit fly) dme-miR-279-3p
  8. Drosophila mojavensis dmo-miR-279
  9. Drosophila persimilis dpe-miR-279
  10. Drosophila pseudoobscura dps-miR-279
  11. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294379_df_nrg
  12. Drosophila sechellia dse-miR-279
  13. Drosophila simulans dsi-miR-279
  14. Drosophila virilis dvi-miR-279-3p
  15. Drosophila willistoni dwi-miR-279
  16. Drosophila yakuba dya-miR-279
  17. Nasonia vitripennis nvi-miR-279
  18. Tribolium castaneum (red flour beetle) tca-miR-279a-3p
Publications