Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Nasonia vitripennis (jewel wasp) nvi-miR-279 URS0000003085_7425

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Nasonia vitripennis. Annotated by 3 databases (miRBase, RefSeq, Ensembl Metazoa). Nasonia vitripennis (jewel wasp) nvi-miR-279 sequence is a product of miR-279, nvi-miR-279, Mir279, GeneID_100526333 genes. Found in the Nasonia vitripennis reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGACUAGAUCCACACUCAUUAA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 18 other species

    1. Aedes aegypti (yellow fever mosquito) aae-miR-279
    2. Anopheles gambiae aga-miR-279
    3. Apis mellifera (honey bee) ame-miR-279a-3p
    4. Culex quinquefasciatus cqu-miR-279-3p
    5. Drosophila ananassae dan-miR-279
    6. Drosophila erecta der-miR-279
    7. Drosophila grimshawi dgr-miR-279
    8. Drosophila melanogaster dme-miR-279-3p
    9. Drosophila mojavensis dmo-miR-279
    10. Drosophila persimilis dpe-miR-279
    11. Drosophila pseudoobscura dps-miR-279
    12. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294379_df_nrg
    13. Drosophila sechellia dse-miR-279
    14. Drosophila simulans dsi-miR-279
    15. Drosophila virilis dvi-miR-279-3p
    16. Drosophila willistoni dwi-miR-279
    17. Drosophila yakuba dya-miR-279
    18. Tribolium castaneum tca-miR-279a-3p
    Publications