Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila melanogaster (fruit fly) dme-miR-279-3p URS0000003085_7227

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Drosophila melanogaster. Annotated by 6 databases (PirBase, ENA, RefSeq, miRBase, MirGeneDB, FlyBase). Drosophila melanogaster (fruit fly) dme-miR-279-3p sequence is a product of mir-279, miR-279-3p, 279-RA, 279-R, mir-279-RA, FBgn0262448, dme-miR-279, dme-miR-279-3p, miR-279 genes. Found in the Drosophila melanogaster reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGACUAGAUCCACACUCAUUAA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 18 other species

    1. Aedes aegypti (yellow fever mosquito) aae-miR-279
    2. Anopheles gambiae aga-miR-279
    3. Apis mellifera (honey bee) ame-miR-279a-3p
    4. Culex quinquefasciatus cqu-miR-279-3p
    5. Drosophila ananassae dan-miR-279
    6. Drosophila erecta der-miR-279
    7. Drosophila grimshawi dgr-miR-279
    8. Drosophila mojavensis dmo-miR-279
    9. Drosophila persimilis dpe-miR-279
    10. Drosophila pseudoobscura dps-miR-279
    11. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294379_df_nrg
    12. Drosophila sechellia dse-miR-279
    13. Drosophila simulans dsi-miR-279
    14. Drosophila virilis dvi-miR-279-3p
    15. Drosophila willistoni dwi-miR-279
    16. Drosophila yakuba dya-miR-279
    17. Nasonia vitripennis nvi-miR-279
    18. Tribolium castaneum tca-miR-279a-3p
    Publications