v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) up-regulated in colorectal cancer liver metastasis (UICLM) URS000075EAD4_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

UICLM: UICLM, a long non-coding RNA (lncRNA), is a promising therapeutic target due to its role in regulating ZEB2 and stemness-related genes, as well as cancer stem cell-associated surface antigens [PMC6888455]. In colorectal cancer, UICLM acts as a competing endogenous RNA (ceRNA) for miR-215, promoting metastasis [PMC8806890]. Overexpression of miR-215 inhibits UICLM expression, while knockdown of UICLM increases miR-215 expression [PMC5706103]. UICLM is involved in the negative regulation of ZEB2 and stemness-related genes. Knockdown of UICLM leads to the downregulation of ZEB2 and inhibits the expression of stemness-related genes such as SOX2, Notch1, CD44, and CD24 [PMC6888455]. This suggests that targeting UICLM could have therapeutic potential in inhibiting cancer stemness. Furthermore, in colorectal cancer metastasis, UICLM acts as a ceRNA for miR-215. This ceRNA activity promotes metastasis by sequestering miR-215 and preventing its interaction with other target genes [PMC8806890]. The relationship between UICLM and miR-215 is bidirectional. Overexpression of miR-215 leads to the downregulation of UICLM expression [PMC5706103]. Conversely, knockdown of UICLM increases the expression level of miR-215 [PMC5706103]. In conclusion, targeting UICLM shows promise as a therapeutic strategy due to its role in regulating ZEB2 and stemness-related genes. Additionally, its ceRNA activity with miR-215 suggests its involvement in promoting colorectal cancer metastasis. Further research is needed to fully understand the mechanisms underlying these interactions and explore the potential of UICLM as a therapeutic target.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCCAGGGCUUUCUGCAGCUGCCCCACGCGGCUCUGGGCCCGGGCACACCUGCACUCUGCCUCGCUCAGCCGGCUGCUCAGGGUCGCCAUCUGGAUGCGGGAGUCAUCCUGGGCAGAAGGACUGAGCCUAGCCUGGUACCUCUGCCACCUGCUGUGAGGGCUGUGCCAUCCUGCCCAGCUGCCCCACAGGGGCCUUUCUAGAGCCCCAGCCAGGCCGUUGGCCUCCCUCUGCUCCCCAGCUCUGCACCACCUCCUGGAGGCCACCUGUGACCUAUCUUGCCUGCUGGAUGGGAACUCCCUGUGGGCAGGGACAGAUGGUGGCCCGCAGCUCGCUGUUGAAAAGCAACAGUACGUCCUUCUCGCGGGCCUCGUCACUCAGCGCCCGGCGGGCCUCCUGGGCCUCCCUGUGCAGCCCCUCCCGGCUCUCCUCGACGCCCUGCAGCUCCUGGCGCAGUGCGGCCAGUCCCUCCUGGGCCACGGUCAGCUGUGCCCGCAGCCUCUCAGCCUGGGGAGGACCAUUCAGCUCUAGAGGCCCGCUGGGGACCACUGCUCCAGGGAUAGCCACAGGGGCCUGUGGCCUCUGACAUGGUGUGGCAGGCACAGGUGCCCUGCCCAACUUGGUCCCCAUGCGCUUUGCUCACCCCAUGGAGCCACCAAUCCCUAGUGCUGCGGAGGCUGCAGGGCGGCUUCCACGGGCUGAGGCAGGGCCAGCCUAAGAGCCCAGAAGACCCCACCUUGAGCCCCUGGGCCCGGCCCCACGCUGCGGCCUCUCUGGACCCCCAGGACGCUGACCACUGCCGCUAGGUCCUGGAGGCUCUCGCGUAGGGCCGUGGUCUCCCUCUGAUGGGCUGUGAUGGCAUCCUCAAACUGGGCCUGGAGGGCCUUCAGCUCCUCAGUCGUGGCACUGAUGGUGGCCUGCGGGGAGAAGGGAGCCCACGGUGGCACCAGGGAGCUGGGCCCAGCAGUGGAGGGUGAGGCUGCUGGGAUGAGGAGACAUCCACGGCCCCUGACAGCUGUGAUGUCGCCCUCUCCCGCUGCGCAGUGCCCUGGGGAUGGGGCACAAGCCCUCCAUCCCGGCUCCGAGUCACCGAGCGUCCCCCAAGGCCCCGCUGCCUGGACGCCCCGGCCCCCCAGCAGGCGGCCUGCGCGUGCCUCUGUGCAGUCAGUGAGAAGGGCUCCCGUUCAGAAUGGGCAGAGAAGGGGGCUGCCUCCCGCGCCUGGCACCAUGGCCUGUGUUCUGUUCACUGCACACUGAACCAUACAUUCAACGCCAGUCAGGACUCAAUGUGGGUGUCCUUUCCUGCCGAGAGUUUCCUCUGGUGCAGGGCCAGCCGCCUCGGGUUGUUUCUCCUUUGGAAGGAUCUCUCUGGGACAGGGCCUGAACAGGACGGGGCAACACUUGAUGCAGUGCAGAGAAGAAAGCUUAAAAGCCCGAAAAUGCUCCAUCUCCCUGAUGGUGUGGGAGAUGCGUGUGAGCGAGACACCCUCAGCUCCAAGGGUGGCACGCUGCUCCGUGGACCAGGCUGUGGAAGCAAUGCCUGUCAAAUCCACACAUGUAUAUUCUCUCUAUGCCCAGGCCCAUCUGGGGGAGGGCAGCCCAGAGACACGUGUGCACCUGUGUGGGCUGACCUAUGCGCAGUGUCACCAAUGUCUGUGACAUUGCUGUAAUGGCAACAAAGCUGGAGGCAACCCAGAUGCCCGUGGAAGGAAGAACAGCCACAGGAAGACCCAGUUCUGGCAGCUCAGCAUGCAGCCCAGAAACAGAAGAACAAAGCUGCAGAUACACAGCUGGGAAAGGCCACCGAGAUGCUUUGAUAAGUGAGAAGAGGAAAGCCCAGGAGCCGGCAUAGACUUUUCAUUCCUUUUGUAUUAAAAAUGCAGUGUUGGGGAGGUAACGCUGUAUAUUUCUGUUUGCAAGCAAUCUUUGGAGGGUGUUGCAUAACAGAAGAUGUAUCAGGUCUUUGUCCUGGAUCCUCGGAGGAAGCUUCUAAACCCUGGGGGUUUCUCAGAAGUGUGGAGCGUCUGCAUUAGUCCUGGCGGGCCCCUGGGACCACACCUGAGUUUAUGCUAAUGAGGUGACUCAGGGUGGGUUCCUACUGAAUUUCAGGAUGGGGACUGUCUGCUGAAAGACCCGUUAUUAGAGGGUUGGGGCUUUGAGCCACGGGAUGUCAGCCCAACCUCCCAGCAGUCAGAGAAGUGGGCUUCAAUCACCUAACCAAUCACUCCACCGAUCACGUUACACAGUGAAACCCCAAUAAAACUCUGGACACCAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications