v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pundamilia nyererei pny-miR-218b URS000075D62B_303518

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUGUGCUUGAUCUAACCAUGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Danio rerio dre-miR-218b
  2. Gadus morhua Gmo-Mir-218-P3_5p (mature (guide))
  3. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-218b
  4. Maylandia zebra (zebra mbuna) mze-miR-218b
  5. Monopterus albus (swamp eel) Mal-Mir-218-P3_5p (mature (guide))
  6. Neolamprologus brichardi (lyretail cichlid) nbr-miR-218b
  7. Oreochromis niloticus (Nile tilapia) oni-miR-218b
  8. Takifugu rubripes fru-miR-218b
  9. Tetraodon nigroviridis tni-miR-218b
  10. Tor tambroides miR-218b