Danio rerio (zebrafish) dre-miR-218b URS000075D62B_7955

• 22 nucleotides
• 3 databases (ENA, miRBase, RefSeq)
• Found in 10 other species
• 2 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UUGUGCUUGAUCUAACCAUGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

1. Gadus morhua Gmo-Mir-218-P3_5p (mature (guide))
2. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-218b
3. Maylandia zebra (zebra mbuna) mze-miR-218b
4. Monopterus albus (swamp eel) Mal-Mir-218-P3_5p (mature (guide))
5. Neolamprologus brichardi (lyretail cichlid) nbr-miR-218b
6. Oreochromis niloticus (Nile tilapia) oni-miR-218b
7. Pundamilia nyererei pny-miR-218b
8. Takifugu rubripes fru-miR-218b
9. Tetraodon nigroviridis tni-miR-218b
10. Tor tambroides miR-218b

Publications Download

• FASTA
• JSON