Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1213 (LINC01213) URS000075D3C0_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01213: LINC01213 is a long noncoding intergenic RNA that has been reported in breast cancer [PMC8930242]. In a study analyzing the role of LINC01213 in prostate cancer, it was found that LINC01213 was upregulated in prostate cancer and its expression correlated with prognosis, with higher expression associated with worse prognosis [PMC8930242]. The study also investigated the androgen-dependent effect of LINC01213 on ADPC cells and found that downregulating LINC01213 inhibited cell proliferation under normal conditions and prevented proliferation in the absence of androgen [PMC8930242]. The study used siRNA targeting human LINC01213 to downregulate its expression [PMC8930242]. Additionally, it was discovered that upregulation of LINC01213 activated the Wnt/β-catenin pathway, which is involved in cancer progression [PMC8930242]. Another study demonstrated that upregulated LINC01213 in exosomes derived from androgen-independent prostate cancer cells induced androgen independency by activating the Wnt/β-catenin signaling pathway [PMC9849294]. Furthermore, LINC01213 was identified as one of the lncRNAs present in specific gene modules associated with prostate cancer [PMC7134052]. Overall, these findings suggest that LINC01213 may serve as a therapeutic target for patients with castration-resistant prostate cancer (CRPC) [PMC8930242].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACCAAUGUGAUGAGUGUGGGGAAGGCCAUAGAAAGGACCGGCGAAUGCUGGCAUUGAUGUGUGUUAUUUUAACAUUUCUGAAAUCCUGUUCUUAGUCUGCACACCUUGUCCGAGGCUCCGAUGUUAUCCAGGUCACCAGGUAUGCCCCUGGGCUCCUGCCGCAGCUGAUCGGGUGCUAGGUGCUGAGGAUACACGUCUGGGAGAAAGCAAUUGGAAGAAAUGCAAAGCUCUUCAAAGGAGACCUAUAAAGUCAUCUUUGUUUUGUUCAUUCUUCUCAUGUUUCUGCAUUCUGGGCAUUCUCCUAAAUUGGGGAGAAACCAAAAUGCCCAGAAGUCAAAUUCUGCAACUGUCAUCAUGCAAAAUGUCAAAUGAGAGAACCAAAGUAUGCUGGAUUCUAUAUUGUUAGGAAGGGAUGGUUAAUUUGAUUGACUCUUGGGAGCUAUUUUUCUAGCAUUAAGUAAUUCUAGGGAACCCUUCUGUGAUCAUCUCUGAGUAAAUAAAGAAGUGAAAUUGCAAUUCAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications