Tetraodon nigroviridis (spotted green pufferfish) tni-miR-10c URS000075D0EB_99883

• 22 nucleotides
• 2 databases (miRBase, MirGeneDB)
• Found in 12 other species
• 1 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UACCCUGUAGAUCCGGAUUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

1. Danio rerio dre-miR-10c-5p
2. Gadus morhua gmo-miR-10c-5p
3. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-10c
4. Ictalurus punctatus (channel catfish) ipu-miR-10c
5. Maylandia zebra (zebra mbuna) mze-miR-10c
6. Monopterus albus (swamp eel) Mal-Mir-10-P1c1-v1_5p (mature (guide))
7. Neolamprologus brichardi (lyretail cichlid) nbr-miR-10c
8. Oreochromis niloticus (Nile tilapia) oni-miR-10c
9. Pundamilia nyererei pny-miR-10c
10. Salmo salar ssa-miR-10a-5p
11. Takifugu rubripes fru-miR-10c
12. Tor tambroides miR-10c-5p

Publications Download

• FASTA
• JSON