Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Neolamprologus brichardi (lyretail cichlid) nbr-miR-10c URS000075D0EB_32507

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACCCUGUAGAUCCGGAUUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Danio rerio dre-miR-10c-5p
  2. Gadus morhua gmo-miR-10c-5p
  3. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-10c
  4. Ictalurus punctatus (channel catfish) ipu-miR-10c
  5. Maylandia zebra (zebra mbuna) mze-miR-10c
  6. Monopterus albus (swamp eel) Mal-Mir-10-P1c1-v1_5p (mature (guide))
  7. Oreochromis niloticus (Nile tilapia) oni-miR-10c
  8. Pundamilia nyererei pny-miR-10c
  9. Salmo salar ssa-miR-10a-5p
  10. Takifugu rubripes fru-miR-10c
  11. Tetraodon nigroviridis tni-miR-10c
  12. Tor tambroides miR-10c-5p