Tetraodon nigroviridis (spotted green pufferfish) tni-let-7h URS000075BD78_99883

• 22 nucleotides
• 2 databases (miRBase, MirGeneDB)
• Found in 13 other species
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UGAGGUAGUAAGUUGUGUUGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

1. Danio rerio dre-let-7h
2. Gadus morhua gmo-let-7h-5p
3. Haplochromis burtoni (Burton's mouthbrooder) abu-let-7h
4. Ictalurus punctatus (channel catfish) ipu-let-7h
5. Lepisosteus oculatus (spotted gar) Loc-Let-7-P2b3_5p (mature (guide))
6. Maylandia zebra (zebra mbuna) mze-let-7h
7. Monopterus albus (swamp eel) Mal-Let-7-P2b3a_5p (mature (guide))
8. Neolamprologus brichardi (lyretail cichlid) nbr-let-7h
9. Oreochromis niloticus (Nile tilapia) oni-let-7h
10. Pundamilia nyererei pny-let-7h
11. Salmo salar ssa-let-7h-5p
12. Takifugu rubripes fru-let-7h
13. Tor tambroides let-7h

Download

• FASTA
• JSON