v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ictalurus punctatus (channel catfish) ipu-let-7h URS000075BD78_7998

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGAGGUAGUAAGUUGUGUUGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Danio rerio dre-let-7h
  2. Gadus morhua gmo-let-7h-5p
  3. Haplochromis burtoni (Burton's mouthbrooder) abu-let-7h
  4. Lepisosteus oculatus (spotted gar) Loc-Let-7-P2b3_5p (mature (guide))
  5. Maylandia zebra (zebra mbuna) mze-let-7h
  6. Monopterus albus (swamp eel) Mal-Let-7-P2b3a_5p (mature (guide))
  7. Neolamprologus brichardi (lyretail cichlid) nbr-let-7h
  8. Oreochromis niloticus (Nile tilapia) oni-let-7h
  9. Pundamilia nyererei pny-let-7h
  10. Salmo salar ssa-let-7h-5p
  11. Takifugu rubripes fru-let-7h
  12. Tetraodon nigroviridis tni-let-7h
  13. Tor tambroides let-7h