v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oreochromis niloticus (Nile tilapia) oni-miR-460 URS000075B588_8128

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CACAGCGCAUACAAUGUGGAUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Cyprinus carpio (common carp) ccr-miR-460-3p
  2. Danio rerio dre-miR-460-3p
  3. Gadus morhua Gmo-Mir-460-P1_3p (mature (co-guide))
  4. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-460
  5. Maylandia zebra (zebra mbuna) mze-miR-460
  6. Neolamprologus brichardi (lyretail cichlid) nbr-miR-460
  7. Pundamilia nyererei pny-miR-460
  8. Salmo salar ssa-miR-460-3p
  9. Takifugu rubripes fru-miR-460
  10. Tetraodon nigroviridis tni-miR-460
  11. Tor tambroides miR-460-3p
  12. Xenopus laevis (African clawed frog) Xla-Mir-460-P1b_3p (mature (co-guide))