Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Maylandia zebra (zebra mbuna) mze-miR-460 URS000075B588_106582

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CACAGCGCAUACAAUGUGGAUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Cyprinus carpio (common carp) ccr-miR-460-3p
  2. Danio rerio dre-miR-460-3p
  3. Gadus morhua Gmo-Mir-460-P1_3p (mature (co-guide))
  4. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-460
  5. Neolamprologus brichardi (lyretail cichlid) nbr-miR-460
  6. Oreochromis niloticus (Nile tilapia) oni-miR-460
  7. Pundamilia nyererei pny-miR-460
  8. Salmo salar ssa-miR-460-3p
  9. Takifugu rubripes fru-miR-460
  10. Tetraodon nigroviridis tni-miR-460
  11. Tor tambroides miR-460-3p
  12. Xenopus laevis (African clawed frog) Xla-Mir-460-P1b_3p (mature (co-guide))