Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-22a-3p URS000075B0BF_7955

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

dre-mir-22a: Dre-mir-22a is a miRNA that has been selected for expression profiling in zebrafish early development due to its known or potential roles in this process [PMC3932949]. It is part of the top 5 most abundant miRNA families expressed at each stage of zebrafish development [PMC3932949]. The expression levels of dre-mir-22a, along with three other known miRNAs, were determined using quantitative real-time PCR assays [PMC3932949]. The expression patterns of dre-mir-22a in zebrafish early development were found to be consistent with the studies conducted in the early development of chicken [PMC3932949]. Dre-mir-22a was highly expressed from the 1-cell stage to 24hpf in zebrafish embryos [PMC3932949]. The sequence for dre-mir-22a-MO, a morpholino oligonucleotide used for knockdown experiments, was provided [PMC8984383]. Additionally, a custom-designed TaqMan MicroRNA assay for dre-mir-22a was used for further analysis [PMC8984383]. Overall, dre-mir-22a is an important miRNA that plays a role in zebrafish early development and its expression patterns have been characterized using various experimental techniques.

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGCUGCCAGCUGAAGAACUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Cyprinus carpio (common carp) ccr-miR-22a
  2. Gadus morhua Gmo-Mir-22-P1b1_3p (mature (guide))
  3. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-22a
  4. Ictalurus punctatus (channel catfish) ipu-miR-22a
  5. Maylandia zebra (zebra mbuna) mze-miR-22a
  6. Monopterus albus (swamp eel) Mal-Mir-22-P1b1_3p (mature (guide))
  7. Mus musculus Mus_musculus piRNA piR-mmu-49806751
  8. Neolamprologus brichardi (lyretail cichlid) nbr-miR-22a
  9. Oreochromis niloticus (Nile tilapia) oni-miR-22a
  10. Paralichthys olivaceus pol-miR-22-3p
  11. Pundamilia nyererei pny-miR-22a
  12. Salmo salar ssa-miR-22a-3p
  13. Takifugu rubripes fru-miR-22a
  14. Tetraodon nigroviridis tni-miR-22a
  15. Tor tambroides miR-22a-3p
  16. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-3648965
Publications