Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-49806751 URS000075B0BF_10090

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGCUGCCAGCUGAAGAACUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Cyprinus carpio (common carp) ccr-miR-22a
  2. Danio rerio dre-miR-22a-3p
  3. Gadus morhua Gmo-Mir-22-P1b1_3p (mature (guide))
  4. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-22a
  5. Ictalurus punctatus (channel catfish) ipu-miR-22a
  6. Maylandia zebra (zebra mbuna) mze-miR-22a
  7. Monopterus albus (swamp eel) Mal-Mir-22-P1b1_3p (mature (guide))
  8. Neolamprologus brichardi (lyretail cichlid) nbr-miR-22a
  9. Oreochromis niloticus (Nile tilapia) oni-miR-22a
  10. Paralichthys olivaceus pol-miR-22-3p
  11. Pundamilia nyererei pny-miR-22a
  12. Salmo salar ssa-miR-22a-3p
  13. Takifugu rubripes fru-miR-22a
  14. Tetraodon nigroviridis tni-miR-22a
  15. Tor tambroides miR-22a-3p
  16. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-3648965