Bison bison bison (American bison) microRNA 365a (ENSBBBG00000013315.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bison bison bison (American bison) microRNA 365a (ENSBBBG00000013315.1) URS000075AC25_43346

87 nucleotides
1 database (Ensembl)
Found in 10 other species
8 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

ACCGCAGGGAAAAUGAGGGACUUUUGGGGGCAGAUGUGUUUGCAUUCCACUAUCAUAAUGCCCCUAAAAAUCCUUAUUGCUCUUGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

Bos grunniens microRNA 365a (ENSBGRG00000026275.1)
Bos indicus x Bos taurus miRNA (ENSBIXG00000007459.1, ENSBIXG00005013211.1)
Bos mutus (wild yak) microRNA 365a (ENSBMUG00000021665.1)
Bos taurus microRNA bta-mir-365 precursor (bta-mir-365-1)
Capra hircus microRNA 365a (ENSCHIG00000009512.1, ENSCHIG00010025249.1)
Cervus elaphus hippelaphus ncRNA
Cervus hanglu yarkandensis microRNA 365a (ENSCHYG00000007503.1)
Moschus moschiferus (Siberian musk deer) microRNA 365a (ENSMMSG00000014869.1)
Ovis aries miRNA (ENSOARG00000024883.1, ENSOARG00020019623.2)

2D structure

Publications