Bos taurus (cattle) microRNA bta-mir-365 precursor (bta-mir-365-1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) microRNA bta-mir-365 precursor (bta-mir-365-1) URS000075AC25_9913

87 nucleotides
4 databases (ENA, Ensembl, miRBase, RefSeq)
Found in 9 other species
59 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

ACCGCAGGGAAAAUGAGGGACUUUUGGGGGCAGAUGUGUUUGCAUUCCACUAUCAUAAUGCCCCUAAAAAUCCUUAUUGCUCUUGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

Bison bison bison microRNA 365a (ENSBBBG00000013315.1)
Bos grunniens microRNA 365a (ENSBGRG00000026275.1)
Bos indicus x Bos taurus miRNA (ENSBIXG00000007459.1, ENSBIXG00005013211.1)
Bos mutus (wild yak) microRNA 365a (ENSBMUG00000021665.1)
Capra hircus microRNA 365a (ENSCHIG00000009512.1, ENSCHIG00010025249.1)
Cervus elaphus hippelaphus ncRNA
Cervus hanglu yarkandensis microRNA 365a (ENSCHYG00000007503.1)
Moschus moschiferus (Siberian musk deer) microRNA 365a (ENSMMSG00000014869.1)
Ovis aries miRNA (ENSOARG00000024883.1, ENSOARG00020019623.2)

2D structure

Publications