Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 301b (ENSGGOG00000031763.2)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 301b (ENSGGOG00000031763.2) URS000075A590_9595

78 nucleotides
1 database (Ensembl)
Found in 6 other species
26 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

GCCGCAGGUGCUCUGACGAGGUUGCACUACUGUGCUCUGAGAAGCAGUGCAAUGAUAUUGUCAAAGCAUCUGGGACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

Homo sapiens microRNA hsa-mir-301b precursor
Myotis lucifugus miRNA (ENSMLUG00000018066.1)
Pan paniscus (bonobo) microRNA 301b (ENSPPAG00000000527.1)
Pan troglodytes ptr-mir-301b (ENSPTRG00000032389.2)
Pongo abelii miRNA (ENSPPYG00000021284.2)
Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-301b precursor

2D structure

Publications