Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-301b precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-301b precursor URS000075A590_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR301B: MIR301B is a microRNA that has been studied in relation to its expression levels [PMC8109121]. In a study, the expressions of miR-454, miR301a, MIR301B, miR130a, and miR130b were normalized to U6 using the 2-ΔΔCt method [PMC8109121]. This method is commonly used to analyze gene expression levels. The study aimed to investigate the impact of BHLHE40/41 on the expression of MIR130B and MIR301B [PMC6659797]. BHLHE40/41 is a transcription factor that has been associated with various biological processes and diseases [PMC6659797]. By studying its influence on MIR130B and MIR301B expression, researchers aimed to gain insights into the regulatory mechanisms involved in microRNA expression [PMC6659797]. The findings of this study could potentially contribute to a better understanding of the roles played by microRNAs in cellular processes and disease development [PMC6659797]. Further research may be needed to fully elucidate the specific mechanisms by which BHLHE40/41 influences MIR130B and MIR301B expression [PMC6659797].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCGCAGGUGCUCUGACGAGGUUGCACUACUGUGCUCUGAGAAGCAGUGCAAUGAUAUUGUCAAAGCAUCUGGGACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications