Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4304 precursor URS000075A30A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4304: Hsa-mir-4304 is one of the differentially expressed mature miRNAs originating from six pri-miRNAs, including hsa-mir-4304, hsa-mir-26a-2, hsa-mir-199a-1, hsa-mir-4423, hsa-mir-4464, and hsa-mir-4492 [PMC9111935]. There is no evidence of genotype-dependent processing for hsa-mir-4304 [PMC9111935]. The cleavage of hsa-mir-4304 is not affected by the SNP rs7926599 [PMC9111935]. Hsa-miRBase36 records only one mature miRNA for hsa-mir-4304, but both the 5' and 3' arms can produce miRNA molecules [PMC9111935]. Two MIR SNPs were found for hsa-miR-4304 [PMC9111935]. Hsa-miR-eQTL analysis was conducted for several miRNAs including hsa-miR26a2 and hasmiR4492 [PMC9111935]. HSA mir 4304 was identified as one of the seven differentially expressed miRNAs in early disease progression [PMC8005181]. Four out of eight differentially expressed miRNAs were significantly expressed only in the early phase of disease progression including hasmiR4784 and hasmiR7977 as well as hasmir1262 and hasmir4304. The Netherlands had six unique miRNAs including hasmiR98p3 and hasmir381p3 while Australia had four unique miRNAs including hasmir50885p. Wuhan also had four unique miRNAs including hasmir104015p and hasmir67623p. These findings were reported in two separate studies [PMC8005181] [PMC9603374].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGAGAAGUGGCCGGCAUGUCCAGGGCAUCCCCAUUGCUCUGUGACUGCUGCCAUCCUUCUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Publications