Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ovis aries (sheep) microRNA oar-mir-200a precursor URS0000759D91_9940

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

oar-mir-200a: Oar-mir-200a is a miRNA that has been identified in various tissues, including the hypothalamus and distal pituitary [PMC9222358]. It has been shown that miR-200a-3p, a variant of oar-mir-200a, plays a significant role in chickens [PMC9222358]. In the hypothalamic and uterine libraries, oar-mir-200a was found to be one of the common differentially expressed miRNAs [PMC8131964]. It was also observed that oar-mir-200a targets several genes in the VMV reference genome sequence [PMC6339376]. Furthermore, oar-mir-200a was found to be upregulated in lesions-seronegative comparison and could actively target the viral gag gene [PMC6339376]. In addition to its role in uterine libraries, oar-mir-200a was also identified as a common differentially expressed miRNA in ovary libraries [PMC8161056]. Oar-mir-200a belongs to the miR-200 family and is associated with epithelial–mesenchymal transition and seminiferous epithelium development [PMC6385976]. In a comparison between PGA libraries, it was observed that oar-mir-200a was downregulated [PMC7142988]. Finally, qRT-PCR verification confirmed the expression patterns of oar-miR16b, oar-mir-200a, and oar-miR432 in various tissues [PMC8300399].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGCCUCUGUGGACAUCUUACCGGACAGUGCUGGAUUUCUCGGCUCGACUCUAACACUGUCUGGUAACGAUGUUCAAAGGUGACCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications