Bos taurus (cattle) microRNA bta-mir-200a precursor

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) microRNA bta-mir-200a precursor URS0000759D91_9913

86 nucleotides
4 databases (ENA, Ensembl, miRBase, RefSeq)
Found in 7 other species
3563 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

GGGCCUCUGUGGACAUCUUACCGGACAGUGCUGGAUUUCUCGGCUCGACUCUAACACUGUCUGGUAACGAUGUUCAAAGGUGACCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

Bison bison bison microRNA 200a (ENSBBBG00000016228.1)
Bos grunniens miRNA (ENSBGRG00000014850.1, ENSBGRG00000014866.1)
Bos indicus x Bos taurus miRNA (ENSBIXG00000018638.1, ENSBIXG00005012988.1)
Bos mutus (wild yak) microRNA 200a (ENSBMUG00000024614.1)
Moschus moschiferus (Siberian musk deer) microRNA 200a (ENSMMSG00000009903.1)
Ovis aries microRNA oar-mir-200a precursor

Publications